elizabethlol11 elizabethlol11

Today at 10:23 PM
Mathematics

Answered

The price of one share of a company’s stock declined $13.89 every day for 2.5 days. What was the stock’s total decline in price?
Which estimate uses compatible numbers to estimate the problem?
What is the exact answer?

Answer :

Аноним Аноним

Today at 10:28 PM

Answer:

-$14(2.5) & -$34.73

Step-by-step explanation:

Which estimate uses compatible numbers to estimate the problem?

✔ -$14(2.5)

What is the exact answer?

✔ -$34.73

Answer Link

soccermomof4 soccermomof4

Today at 10:29 PM

Answer:

answer is above

Step-by-step explanation:

Answer Link

Other Questions

transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC

Mahesh sketched the map in paasive voice

Why were early radio shows limited on the kinds of sound effects that they could produce? Question options: Sound effects, like the shows, had to be live. There

aa 6. The distance north or south of the equator is called

Why were early radio shows limited on the kinds of sound effects that they could produce? Question options: Sound effects, like the shows, had to be live. There

Find the value of (sin60+cos60)

The following work models how to write the quotient 4 3 2 \f

the population of a country in the year 2004 was 50,000 if the population is reducing by 24 thousand per year what would be the population of a country in the y

the recorded sound files are saved with the extensiona) .midib) .wmac) .wav answer it fast

if a^4+1 / a^2 = 34 find value of (a+ 1/a)

10- Every time we...............to that restaurant, my stomach gets upset.went.have gone.will go.go

dinesh will painted a landscape in passive voice

What is the area of the trapezoid

List 2 positive results of farmers using irrigation.

Roy weighs 120 pounds and plans to gain 2.5 pounds a week. Luis weighs 1 point 220 pounds and plans to lose 3.5 pounds a week. Which equation shows when Roy and

Expand (x-4)^4 with binomial theorem or pascal's triangle SHOW ALL STEPS! PLS HELP ASAP WILL GIVE BRAINLIEST TO WHOEVER SHOWS ALL STEPS!

A Birthday Brainstorm Instead of underlining, type two sentences that support the idea that Olivia is a determined person. Which of these details from the passa

What type of relationship with a bird a fish a tiger and deer have?

0.Who has got the First Arjuna Award in the field of Athletics? * P.T.Usha G.S.Randhawa Milkha Singh plz urjent help plz

Spanish crossword please help ! Complete the following crossword puzzle.