ytawesomegamer2350
ytawesomegamer2350
Today at 10:24 PM
Biology
Answered
what is cementation?
Answer :
Аноним
Аноним
Today at 10:29 PM
Answer:
The binding together of particles or other things by cement.
Explanation:
Hope this helps! <3
Answer Link
VIEW ALL ANSWERS ( 82+ )
Other Questions
HELP ASAP!!! I’m really confused. Thanks!!
Why were early radio shows limited on the kinds of sound effects that they could produce? Question options: Sound effects, like the shows, had to be live. There
Can anyo help me thanks
aa 6. The distance north or south of the equator is called
transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC
horror story in english 100 words
(d) broadcasting3. The nitrogen deficiency of soil can be made up by using uie pupil(a) crop rotation(b) transplantationKc) multiple cropping4. DDT, BHC and Mal
fortuna - heracles
friction is necessary evil explain
what is meant by fermentation,?,
6-..........many times every winter in Istanbul. *It snows It snowedIt is snowingIt is snow
PLEASE I need help ASAP dye tonight please show work if you answer thank you so much 15 points
A table is 2 feet wide it is 6 times as long it is wide
What Is 50.0 g of water, H(2)O
the number of molecules in 68g of NH3
Which zone contains the headwaters of a stream system? A. transition zone. B. source zone. C. floodplain zone. D. delta zone. E. littoral zone.
Which of the following mortgage options will not have a PMI requirement? O A. 3/27 balloon mortgage B. 30-year mortgage O C. 7/1 ARM D. 75/25 mortgage
An amateur drama group hire a theatre for their production. They expect to sell all 850 tickets, some at $12 and the rest at $8. The group require the ticket sa
someone please help me
What is the name of the following ionic compound? AlF3 ASAP QUICCKKKM Look at picture
