anniewinkle1 anniewinkle1

Today at 9:46 AM
Mathematics

Answered

Express the decimal as a percent 1. 276

Answer :

Moongem3000school Moongem3000school

Today at 9:50 AM

Your answer is 1 276/1000

Have a nice day!!!

(If this helps don’t forget to mark branliest :) )

Answer Link

DisBoiDunnowNothin DisBoiDunnowNothin

Today at 9:51 AM

Answer:

ummm to round it, it would round to 1. To say it, it would be one and two hundred seventy six thousandths.

Step-by-step explanation:

Mark as brainliest plz

Answer Link

Other Questions

Un átomo de un elemento tiene 25 electrones y 15 neutrones cuanto protones tiene

Help me choose the right answer!!

Gumbo company had the following transactions during the month of december. What was the december 1 cash balance?.

Charles and Heather are married and will file a joint return. Heather is a U.S. citizen with a valid Social Security number. Charles is a resident alien with an

what was nelson mandela's attitude toward the people who had been responsibie for the old goverment of south africa

which one isgreater in3/2of7/4or5/6of1/7

Using 82946×499= 41390054, find(a)82947×499 ( b) 82946×498(c) 82945×499Please guys help me cause my homework is pending Can't understand the question

hi happy Sunday my question is what is animal husbandry

A imunologia é uma área de estudo de grande relevância em im

Explain the afetlering statementwithJunghe Sith quad cruspararea betet al jou se sfare

PLEASE HELP ASAP will give brainly How long after conception does the new human develop different cell types?

Grant and his friend Ethan went fishing last Saturday. Grant caught 17 fish, and Ethan caught 4 fewer fish than Geant. How mamy fish did the two boys catch in a

Whose side was the U.S. government on when labor (workers) and management (owners) got into a dispute?

Help plss i give 5 stars and crown

In what way are ideas in Greek government used in the US government?

Why is it important to citizens that their government has more than one political party?

Help i give 5 stars and crown

Plz help meeee, ASAP I am trying to help my sister, we have been stuck on this for hours( will give brainlest )

if AB = CD and CD = XY, then AB = XY

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT