Idontknowww127 Idontknowww127

Today at 8:45 PM
Mathematics

Answered

Solve each equation:
(PLEASE help me with this ASAP I will GREATLY appreciate it and I will give brainliest)

Solve each equation: (PLEASE help me with this ASAP I will GREATLY appreciate it and I will give brainliest) class=

Answer :

lhsoftball lhsoftball

Today at 8:49 PM

3. The answer is 13. Fathers first person is incorrect

Answer Link

Other Questions

Mary won £5000 in a competition.She used the money to pay for herself and 8 friendsto go on a holiday.Flights cost £279 for each of them.Accommodation cost £184

What are the things that might have revealed the owners identity and did they carefully check the house

write the name of the five oceans according to the decreaseing order of their size

Describe the importance of right to information for consumers

| हमारे जैसे बहुकोशिकीय जीवों में ऑक्सीजन की आवश्यकता पूरी करने में विसरण क्यों..अपर्याप्त है?

Cohesive forces are also called asa) internal pressure b) External pressure c) molecular structured) Atomic number

Help Quickly!! Look up information on Ash Wednesday, Lent, and Carnival. Write a paragraph on each, telling how these special times are related. Your report sho

The cooking club made some pies to sell at a basketball game to raise money for the new books. The cafeteria contributed four pies to the sale. Each pie was the

-4(4-3p) help me with this question

Solve for x 4x−2=3x+4

Which of the following is known as an American military hero? O A) Daniel Boone OB) William Pitt C General Braddock OD) George Washington

Domain and range of T

Jonas is planning out his route for an upcoming race. He uses negative numbers to represent points beforethe finish line and positive numbers to represent point

A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA…

Filling your individualf ederal tax returns would be best described what type of value chain?

A small square loop carries the current 32A. the on axis magnetic field strength 50 cm for the loop is 4.9 nT. What is the edge length of the square?