charginghypno1563 charginghypno1563

Today at 8:18 PM
Mathematics

Answered

find the length of this rectangular prism

find the length of this rectangular prism class=

Answer :

robertstallone007 robertstallone007

Today at 8:23 PM

Answer:

Volume of rectangle = b×h×l

volume = 9×14×6

volume = 756 square inches

Answer Link

Other Questions

You plan to conduct a marketing experiment in which students are to taste one of two different brands of soft drink. Their task is to correctly identify the bra

You plan to conduct a marketing experiment in which students are to taste one of two different brands of soft drink. Their task is to correctly identify the bra

Question 4: Work out the height of a cylinder Radius of 3cm Surface area = 84 pie

You plan to conduct a marketing experiment in which students are to taste one of two different brands of soft drink. Their task is to correctly identify the bra

Question 4: Work out the height of a cylinder Radius of 3cm Surface area = 84 pie

Explain the changing pattern of democratic form of governance with reference to India

Why did sir percy blakeney not share his secret with his wife?

calculate the coefficient of correlation between x and y from the following data x 10,12,13,16,17,20,25 y 19,22,26,27,33,37

complete the given paragraph with suitable answer. (Question no. 56 to Question no. 60 )........1........was the founder of the Buddhism religion. he was born i

Two-dimensional enclosed space is known as .

00:00Molly wrote 4 stories. Which of her stories does NOT tell a division story?A.00:00I have 28 pennies. I want to share them equally with 7 people.O B.00:00I

The swimming instructor has a list of 152 students who have signed up for swimming lessons. The swimming instructor can register 12 students in each class. What

subtract the exponents (4-2) and solve for 32, which expands into 3 x 3 and equals 9.

Giovani solves a system of equations algebrically he concludes that the lines are parallel which could be the final of his solution

GfK Custom Research North America conducted identical surveys five years apart. One question asked of women was "Are most men basically kind, gentle, and though

GUAAUGAAACGCCUGGUAGAAGGUUGAUGC 1. List the DNA strand sequence from which the mRNA was transcribed: 2. List the complementary DNA sequence to the above DNA stra

With the use of the auxiliary verbs DO or DOES, change the following sentences to the INTERROGATIVE and NEGATIVE forms. 1. Fred and Mary go to school five days

G Where in the museum did Jake and Summer agree to meet? at the Venus De Milo statue at the museum cafe in the Denon wing at the portrait of the Mona Lisa What’

From the given electron configurations, predict which one is for a representative element? A) 1s22s22p63s23p64s2 B) 1s22s22p63s23p63d74s2 C) 1s22s22p63s23p63d64

Furniture costing $75,900 is sold at its book value in 2019. Acquisitions of furniture total $64,300 cash, on which no depreciation is necessary because it is a