Anonyme Anonyme

Today at 5:21 AM
English

Answered

to efectively participate in a group discussion balance must be maintained between

Answer :

ripeg1471 ripeg1471

Today at 5:27 AM

Answer:

speaking and listening

Explanation:

You have to skilfully deliver your speech and know how to listen to others

Answer Link

Other Questions

Nadine was giving a speech at the main intersection of campus, trying to get students to vote for her candidate for state senate. her speech was very passionate

If the sum of two numbers is 20 and one of those numbers is three times the other, what is the smaller number?

models an appropriate response to a feared stimulus in graduated steps, after which the client attempts to imitate the model step-by-step, encouraged and suppo

If the sum of two numbers is 20 and one of those numbers is three times the other, what is the smaller number?

Megachurches have become popular in certain parts of the united states. where else in the world are megachurches widely popular?

jumble words TSALARUAIREEPOU

evaluate 4×(0.81)½ [(0.064)⅓+(0.0625)¼]

equal treatment of women is a necessary ingredient of a democratic society this means thatव्हिच ऑफ द फॉलोइंग स्टेटमेंट आईएस ट्रू व्हिच ऑफ द फॉलोइंग स्टेटमेंट आई

क्या वास्तविक जीवन में दूसरों की भलाई के लिए संपत्ति को इकट्ठा करके रखा जाता है आज के युग में क्या यह संभव है

please give me answer

Why do moderate levels of disturbance result in an increase in community diversity? why do moderate levels of disturbance result in an increase in community div

He human eye is poorly suited to night vision, suffering impairments in .

Hemoglobin is the iron-containing compound that carries oxygen in the bloodstream?

Hannah is a strict parent, and does not recall that she herself got drunk at her senior prom, which does not "fit" with the way she currently views herself. thi

Girls gain more body fat through adolescence than do boys

please help me !!!!!!!!!!!!!!!!!!!!!the emancipation proclamation impacted slaves in the a. south b. north

All of the following MUST be the same for congruent circles EXCEPT A) center B) circumference C) diameter D) radius

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Roosting areas in buildings of any height are the fundamental niche of species 1. 2. interspecific competition between the two bat species occurs because both s

If cells from a carrot are removed and placed in a culture medium, they can develop into a normal adult plant. this demonstrates that carrot cells . see concept